Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5398

expand all nodes | collapse all nodes | view schema

Name Class

Expr5398Expression_ofGeneWBGene00002980
Reflects_endogenous_expression_ofWBGene00002980
HomolHomol_homolC32D5:Expr
Expression_data (2)
TypeReporter_gene[lgg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCACTTTCAAGGCGACAGTA] 3' and primer B 5' [GCCCACTTGATTTTGATTCG] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC13567
ReferenceWBPaper00006525
TransgeneWBTransgene00003209