WormBase Tree Display for Expr_pattern: Expr5412
expand all nodes | collapse all nodes | view schema
Expr5412 | Expression_of | Gene | WBGene00016384 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00016384 | ||||
Homol | Homol_homol | CHROMOSOME_IV:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005300 | |||||
WBbt:0005735 | |||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005821 | |||||
WBbt:0006749 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [C33H5.18a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATTCAAAATAGGCTATCGAAAA] 3' and primer B 5' [GGTTGATCGGAGATCTGAAAAAT] 3'. | |||
Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ; | ||||
Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ; | |||||
Picture | WBPicture0000009293 | ||||
WBPicture0000009294 | |||||
WBPicture0000009295 | |||||
WBPicture0000009296 | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and around vulva.High intensity GFP.Mosaic population. | ||||
Strain: BC12993 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004378 |