WormBase Tree Display for Expr_pattern: Expr5420
expand all nodes | collapse all nodes | view schema
Expr5420 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | C34E10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (12) | |||
Type | Reporter_gene | [atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'. | |
Pattern | Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||
Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
Picture | WBPicture0000004092 | ||
Remark | Also expressed in (comments from author) : high intensity GFP, other tissues may have been masked | ||
Strain: BC13747 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004239 |