Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5420

expand all nodes | collapse all nodes | view schema

Name Class

Expr5420Expression_of (2)
HomolHomol_homolC34E10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[atp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAATTCTGCACTGCAATCAC] 3' and primer B 5' [TAACGAACGCGAAGCGATA] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
PictureWBPicture0000004092
RemarkAlso expressed in (comments from author) : high intensity GFP, other tissues may have been masked
Strain: BC13747
ReferenceWBPaper00006525
TransgeneWBTransgene00004239