Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5513

expand all nodes | collapse all nodes | view schema

Name Class

Expr5513Expression_ofGeneWBGene00016704
Reflects_endogenous_expression_ofWBGene00016704
HomolHomol_homolC46C11:Expr
Expression_data (2)
TypeReporter_gene[C46C11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCAGTGTTTGCGGAAGG] 3' and primer B 5' [CGTTTCGGGATTGTTTCAGT] 3'.
PatternAdult Expression: pharynx; arcade cells; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
RemarkStrain: BC14317
ReferenceWBPaper00006525
TransgeneWBTransgene00003500