Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5569

expand all nodes | collapse all nodes | view schema

Name Class

Expr5569Expression_ofGeneWBGene00001172
Reflects_endogenous_expression_ofWBGene00001172
HomolHomol_homolC51E3:Expr
Expression_data (2)
TypeReporter_gene[egl-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGGCAACAAACTAAAATGAAAA] 3' and primer B 5' [CATGTGTGTTTTTGATACCTTCA] 3'.
PatternAdult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head;
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head;
RemarkStrain: BC12649
ReferenceWBPaper00006525
TransgeneWBTransgene00004337