WormBase Tree Display for Expr_pattern: Expr5580
expand all nodes | collapse all nodes | view schema
Expr5580 | Expression_of | Gene | WBGene00006852 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006852 | ||
Homol | Homol_homol | C53D6:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [unc-129::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAGCAGTTGTCACGAGT] 3' and primer B 5' [CCTGATTTTCTTGCTTGCTCTT] 3'. | |
Pattern | Adult Expression: Nervous System; ventral nerve cord; unidentified cells in head; | ||
Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : There is at least one bright cell near the terminal bulb. | ||
Strain: BC11859 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002724 |