Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5580

expand all nodes | collapse all nodes | view schema

Name Class

Expr5580Expression_ofGeneWBGene00006852
Reflects_endogenous_expression_ofWBGene00006852
HomolHomol_homolC53D6:Expr
Expression_data (2)
TypeReporter_gene[unc-129::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAGCAGTTGTCACGAGT] 3' and primer B 5' [CCTGATTTTCTTGCTTGCTCTT] 3'.
PatternAdult Expression: Nervous System; ventral nerve cord; unidentified cells in head;
Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head;
RemarkAlso expressed in (comments from author) : There is at least one bright cell near the terminal bulb.
Strain: BC11859
ReferenceWBPaper00006525
TransgeneWBTransgene00002724