Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5605

expand all nodes | collapse all nodes | view schema

Name Class

Expr5605Expression_of (2)
HomolHomol_homolCD4:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (22)
TypeReporter_gene[CD4.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTGGCCAAAATAGTTCGTTG] 3' and primer B 5' [TGACTAAAGATTTCGCCCTGA] 3'.
PatternAdult Expression: pharynx; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; developing gonad; developing vulva; gonad sheath cells; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC14263
ReferenceWBPaper00006525
TransgeneWBTransgene00003472