Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5627

expand all nodes | collapse all nodes | view schema

Name Class

Expr5627Expression_ofGeneWBGene00008419
Reflects_endogenous_expression_ofWBGene00008419
HomolHomol_homolD2030:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[D2030.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTCCCGTTCAAACTGAACAA] 3' and primer B 5' [TTCGAGCATAGGGCGAAG] 3'.
PatternAdult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons; tail neurons;
RemarkStrain: BC11003
ReferenceWBPaper00006525
TransgeneWBTransgene00002441