Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5637

expand all nodes | collapse all nodes | view schema

Name Class

Expr5637Expression_ofGeneWBGene00008439
Reflects_endogenous_expression_ofWBGene00008439
HomolHomol_homolDY3:Expr
Expression_data (2)
TypeReporter_gene[DY3.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAGAAAGTTGACCAATTTGATTT] 3' and primer B 5' [TCCAATGAATGGGATTTTGAA] 3'.
PatternAdult Expression: Reproductive System; gonad sheath cells; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: hypodermis; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC13037
ReferenceWBPaper00006525
TransgeneWBTransgene00003074