Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5644

expand all nodes | collapse all nodes | view schema

Name Class

Expr5644Expression_ofGeneWBGene00017098
Reflects_endogenous_expression_ofWBGene00017098
HomolHomol_homolC37A2:Expr
Expression_data (2)
TypeReporter_gene[E02D9.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGATGTTTGCAAATTTTCCATT] 3' and primer B 5' [TGGGTCGATTATGACTGTGAG] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : unidentified cells in tail, possibly neural
Strain: BC12991
ReferenceWBPaper00006525
TransgeneWBTransgene00003061