WormBase Tree Display for Expr_pattern: Expr5645
expand all nodes | collapse all nodes | view schema
Expr5645 | Expression_of | Gene | WBGene00000952 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000952 | ||
Homol | Homol_homol | E02H4:Expr | |
Expression_data | Life_stage (2) | ||
Anatomy_term | WBbt:0005300 | ||
WBbt:0005735 | |||
Type | Reporter_gene | [del-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTCAATATTGCTGCTCGGATA] 3' and primer B 5' [TTTTTCACCCCATCTTTTCAA] 3'. | |
Pattern | Adult Expression: Nervous System; ventral nerve cord; | ||
Larval Expression: Nervous System; ventral nerve cord; unidentified cells; | |||
Picture | WBPicture0000004455 | ||
Remark | Also expressed in (comments from author) : Strain is not available as of 3 Dec 2003 | ||
Strain: BC11424 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002591 |