WormBase Tree Display for Expr_pattern: Expr5646
expand all nodes | collapse all nodes | view schema
Expr5646 | Expression_of | Gene | WBGene00003169 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003169 | ||
Homol | Homol_homol | E03G2:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (5) | |||
Type | Reporter_gene | [mec-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGTTCAAAGAACAATTTAAGG] 3' and primer B 5' [TCATGAAAAGCTGTTGAAAACAA] 3'. | |
Pattern | Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | |||
Picture | WBPicture0000009166 | ||
WBPicture0000009167 | |||
WBPicture0000009168 | |||
WBPicture0000009169 | |||
WBPicture0000009170 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11600 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002630 |