WormBase Tree Display for Expr_pattern: Expr5646
expand all nodes | collapse all nodes | view schema
Expr5646 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | E03G2:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005300 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0006750 | |||||
Type | Reporter_gene | [mec-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGTTCAAAGAACAATTTAAGG] 3' and primer B 5' [TCATGAAAAGCTGTTGAAAACAA] 3'. | |||
Pattern | Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000009166 | ||||
WBPicture0000009167 | |||||
WBPicture0000009168 | |||||
WBPicture0000009169 | |||||
WBPicture0000009170 | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC11600 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002630 |