WormBase Tree Display for Expr_pattern: Expr5659
expand all nodes | collapse all nodes | view schema
Expr5659 | Expression_of | Gene | WBGene00004204 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004204 | ||||
Homol | Homol_homol | T05E11:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005733 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | Partial | ||||
Remark | ant and post cells | ||||
WBbt:0005800 | |||||
Type | Reporter_gene | [psa-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAGGCTCCAGCTGCAAGA] 3' and primer B 5' [CCTTCCGCTGATTCTTCAAA] 3'. | |||
Pattern | Adult Expression: intestine - ant and post cells; rectal epithelium; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: intestine - ant and post cells; rectal epithelium; hypodermis; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000004557 | ||||
WBPicture0000009127 | |||||
WBPicture0000009128 | |||||
WBPicture0000009129 | |||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, possibly neural.Strain not available. | ||||
Strain: BC11211 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004223 |