WormBase Tree Display for Expr_pattern: Expr5670
expand all nodes | collapse all nodes | view schema
| Expr5670 | Expression_of | Gene | WBGene00006166 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00006166 | ||
| Homol | Homol_homol | F54D1:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005772 | ||
| Type | Reporter_gene | [str-115::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGATTGAATAACTTTTTATGACCA] 3' and primer B 5' [TGAATTTTTGTTCTTCTATACGTGA] 3'. | |
| Pattern | Adult Expression: intestine; | ||
| Larval Expression: intestine; | |||
| Picture | WBPicture0000004591 | ||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. Can predict correct product. | ||
| Strain: BC16203 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004196 |
