WormBase Tree Display for Expr_pattern: Expr5693
expand all nodes | collapse all nodes | view schema
| Expr5693 | Expression_of | Gene | WBGene00003980 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00003980 | ||
| Homol | Homol_homol | F09C3:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0005300 | |||
| WBbt:0005733 | |||
| WBbt:0005735 | |||
| WBbt:0006749 | |||
| WBbt:0006750 | |||
| WBbt:0006751 | |||
| WBbt:0006759 | |||
| WBbt:0006769 | |||
| Type | Reporter_gene | [pes-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTTGGGAAATGAGCCTTC] 3' and primer B 5' [GCTGGTTCGGTTTCGATAGTT] 3'. | |
| Pattern | Adult Expression: hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; | ||
| Larval Expression: hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC12773 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003010 |
