WormBase Tree Display for Expr_pattern: Expr5822

Expr5822 Expression_of: Gene: WBGene00001028
    Reflects_endogenous_expression_of: WBGene00001028
  Homol: Homol_homol: F22B7:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
  Type: Reporter_gene: [dnj-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGATGATGTGACAATGACG] 3' and primer B 5' [TCCGAGTACCCTGAAACAAAT] 3'.
  Pattern: Adult Expression: pharynx; unidentified cells in head; unidentified cells in tail ;
    Larval Expression: intestine; unidentified cells in head; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC10375
  Reference: WBPaper00006525
  Transgene: WBTransgene00002217