WormBase Tree Display for Expr_pattern: Expr5834
expand all nodes | collapse all nodes | view schema
Expr5834 | Expression_of | Gene | WBGene00009082 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009082 | ||
Homol | Homol_homol | F23B12:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (11) | |||
Type | Reporter_gene | [F23B12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCATCTCATCCTTTCCCT] 3' and primer B 5' [GGGAACTTCGAGATTACCTGAATA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulva other; body wall muscle; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : GFP intensity is quite high, and it is difficult to distinguish some tissues. | ||
Strain: BC11033 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002455 |