WormBase Tree Display for Expr_pattern: Expr5867

Expr5867 Expression_of: Gene: WBGene00017808
    Reflects_endogenous_expression_of: WBGene00017808
  Homol: Homol_homol: F26A1:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005300
      WBbt:0005735
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0006750
  Type: Reporter_gene: [F26A1.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTCTTGACATACAAGCGAGACTG] 3' and primer B 5' [TTGTCAGCGATTTCTTCTTCTTC] 3'.
  Pattern: Adult Expression: Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head;
    Larval Expression: intestine; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC12386
  Reference: WBPaper00006525
  Transgene: WBTransgene00002911