Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5884

expand all nodes | collapse all nodes | view schema

Name Class

Expr5884Expression_ofGeneWBGene00009174
Reflects_endogenous_expression_ofWBGene00009174
HomolHomol_homolF26H9:Expr
Expression_data (2)
TypeReporter_gene[F26H9.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTCAAGCTTTTCCGT] 3' and primer B 5' [CTTCATTTGACGTGATTTCTGA] 3'.
PatternAdult Expression: rectal epithelium; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: rectal epithelium; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14539
ReferenceWBPaper00006525
TransgeneWBTransgene00003596