WormBase Tree Display for Expr_pattern: Expr5948
expand all nodes | collapse all nodes | view schema
| Expr5948 | Expression_of | Gene | WBGene00001335 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00001335 | ||
| Homol | Homol_homol | F35A5:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005300 | |||
| WBbt:0005735 | |||
| WBbt:0005747 | |||
| WBbt:0005813 | |||
| WBbt:0005821 | |||
| WBbt:0006751 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [erp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAATGGTTGTAGCGTATTTGC] 3' and primer B 5' [TCGATACTGAGTTTTCAACAATCT] 3'. | |
| Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; tail neurons; | ||
| Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC10597 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002326 |
