Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6026

expand all nodes | collapse all nodes | view schema

Name Class

Expr6026Expression_ofGeneWBGene00018294
Reflects_endogenous_expression_ofWBGene00018294
HomolHomol_homolF41E6:Expr
Expression_data (2)
TypeReporter_gene[F41E6.13a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTCCAAAAATGCCACCAAG] 3' and primer B 5' [TCCTGGAAACCAAGAAAAGAG] 3'.
PatternAdult Expression: pharynx; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC13209
ReferenceWBPaper00006525
TransgeneWBTransgene00008538