Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6043

expand all nodes | collapse all nodes | view schema

Name Class

Expr6043Expression_ofGeneWBGene00009632
Reflects_endogenous_expression_ofWBGene00009632
HomolHomol_homolF42E11:Expr
Expression_dataLife_stage (2)
Anatomy_term (15)
TypeReporter_gene[F42E11.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGAATTTTGGTGAATGGGTACA] 3' and primer B 5' [ACGCAAATGTGATTTTGGTGT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC13245
ReferenceWBPaper00006525
TransgeneWBTransgene00003114