WormBase Tree Display for Expr_pattern: Expr6063
expand all nodes | collapse all nodes | view schema
Expr6063 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | F43G9:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005772 | |||||
WBbt:0005813 | |||||
WBbt:0005821 | |||||
Type | Reporter_gene | [F43G9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCATATCGTTTTGGAAACCT] 3' and primer B 5' [CAAAAATATTTGAGATGGAAGGAA] 3'. | |||
Pattern | Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; unidentified cells in head; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : possibly a few neurons in head and tail | ||||
Strain: BC10381 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002222 |