WormBase Tree Display for Expr_pattern: Expr6107
expand all nodes | collapse all nodes | view schema
| Expr6107 | Expression_of | Gene | WBGene00018572 | ||
|---|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00018572 | ||||
| Homol | Homol_homol | F47F6:Expr | |||
| Expression_data | Life_stage | WBls:0000041 | |||
| WBls:0000023 | |||||
| Anatomy_term | WBbt:0003681 | ||||
| WBbt:0005739 | Partial | ||||
| Remark | unidentified cells | ||||
| WBbt:0005753 | |||||
| Type | Reporter_gene | [lin-42::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTAACCGGTCACTCTGTACTCTG] 3' and primer B 5' [CTCGATTTGGCTGATGGTG] 3'. | |||
| Pattern | Adult Expression: pharynx; seam cells; unidentified cells in head; | ||||
| Larval Expression: seam cells; | |||||
| Picture | WBPicture0000005356 | ||||
| WBPicture0000005357 | |||||
| WBPicture0000005358 | |||||
| Remark | Also expressed in (comments from author) : Notes were not entered into database, and images are only for larval/adult. Have extrapolated data from the images, but this leaves the analysis incomplete.GFP in the head may be arcade cells, hard to tell from image. | ||||
| Strain: BC13765 | |||||
| Reference | WBPaper00006525 | ||||
| Transgene | WBTransgene00003274 |
