WormBase Tree Display for Expr_pattern: Expr6119
expand all nodes | collapse all nodes | view schema
Expr6119 | Expression_of | Gene | WBGene00018621 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018621 | ||||
Homol | Homol_homol | F48G7:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005741 | Partial | |||
Remark | unidentified cells | ||||
Type | Reporter_gene | [F48G7.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGAAATTAAACTTCCCAGCAAAA] 3' and primer B 5' [GTGGCTCGGTGGAGATTG] 3'. | |||
Pattern | Adult Expression: unidentified cells; unidentified cells in tail ; | ||||
Larval Expression: unidentified cells; unidentified cells in tail ; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. Will be updated. | ||||
Strain: BC11529 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002615 |