Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6163

expand all nodes | collapse all nodes | view schema

Name Class

Expr6163Expression_ofGeneWBGene00000195
Reflects_endogenous_expression_ofWBGene00000195
HomolHomol_homolF53H8:Expr
Expression_dataLife_stage (2)
Anatomy_term (13)
TypeReporter_gene[arr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTTGGCCCCGTTATAGT] 3' and primer B 5' [TGACTAGTAAACTAGCAATCGAGC] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : unidentified cells in tail, possibly neural
Strain: BC12988
ReferenceWBPaper00006525
TransgeneWBTransgene00004511