Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6167

expand all nodes | collapse all nodes | view schema

Name Class

Expr6167Expression_ofGeneWBGene00018788
Reflects_endogenous_expression_ofWBGene00018788
HomolHomol_homolF54A5:Expr
Expression_data (2)
TypeReporter_gene[F54A5.3d::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCTCAGGCTCATGCTT] 3' and primer B 5' [ACTCGAAATTCGTTACAACCG] 3'.
PatternAdult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: anal depressor muscle; Reproductive System; developing vulva; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC12999
ReferenceWBPaper00006525
TransgeneWBTransgene00003062