WormBase Tree Display for Expr_pattern: Expr6192

Expr6192 Expression_of: Gene: WBGene00018866
    Reflects_endogenous_expression_of: WBGene00018866
  Homol: Homol_homol: F55A12:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005738 Partial
        Remark: unidentified cells
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005767
      WBbt:0005772
      WBbt:0005799
      WBbt:0005812
      WBbt:0005813
  Type: Reporter_gene: [F55A12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACGTTTAGTGCAAGTGATAACG] 3' and primer B 5' [GGTCCTGATCTTCAAAGAAAACA] 3'.
  Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
    Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
  Picture: WBPicture0000005559
    WBPicture0000005560
    WBPicture0000005561
  Remark: Also expressed in (comments from author) : Unidentified tail cell is possibly anal sphincter muscle. Cell in head is high-intensity GFP and is below the terminal bulb of the pharynx where it forms two low-intensity arms that go up into head and down to tail. Perhaps misplaced excretory cell?
    Strain: BC10680
  Reference: WBPaper00006525
  Transgene: WBTransgene00004219