WormBase Tree Display for Expr_pattern: Expr6203
expand all nodes | collapse all nodes | view schema
| Expr6203 | Expression_of | Gene | WBGene00006805 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00006805 | ||
| Homol | Homol_homol | C09D1:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003681 | ||
| WBbt:0005300 | |||
| WBbt:0005735 | |||
| WBbt:0005772 | |||
| WBbt:0006749 | |||
| WBbt:0006751 | |||
| WBbt:0006759 | |||
| Type | Reporter_gene | [unc-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACACCGATATGGTTTTTGACAT] 3' and primer B 5' [ATGGAGGAATTTTATGCGAATTT] 3'. | |
| Pattern | Adult Expression: pharynx; intestine; unidentified cells; | ||
| Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. Adults occassionally have same GFP pattern as larvae. | ||
| Strain: BC11480 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002606 |
