WormBase Tree Display for Expr_pattern: Expr6204
expand all nodes | collapse all nodes | view schema
Expr6204 | Expression_of | Gene | WBGene00018877 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018877 | ||
Homol | Homol_homol | F55D10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (6) | |||
Type | Reporter_gene | [F55D10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAAAATTGTTCATTGAATTTG] 3' and primer B 5' [TGGAGGTTGATGCTTCCTAGAT] 3'. | |
Pattern | Adult Expression: intestine; Nervous System; head neurons; neurons along body; tail neurons; | ||
Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; | |||
Picture | WBPicture0000005577 | ||
WBPicture0000005578 | |||
WBPicture0000005579 | |||
Remark | Also expressed in (comments from author) : 2nd analysis, 2yrs later: only the gut, coelomocytes, and VNC express.1st analysis: Larval expressing in the VNC do not express in the gut. | ||
Strain: BC11477 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002605 |