Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6215

expand all nodes | collapse all nodes | view schema

Name Class

Expr6215Expression_ofGeneWBGene00001748
Reflects_endogenous_expression_ofWBGene00001748
HomolHomol_homolF56C9:Expr
Expression_data (2)
TypeReporter_gene[gsp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTGGTGAAGAACAGAACACAA] 3' and primer B 5' [TACGTCGATTTGTTGCGAGA] 3'.
PatternAdult Expression: anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; tail neurons;
Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC10077
ReferenceWBPaper00006525
TransgeneWBTransgene00002066