Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6319

expand all nodes | collapse all nodes | view schema

Name Class

Expr6319Expression_ofGeneWBGene00000044
Reflects_endogenous_expression_ofWBGene00000044
HomolHomol_homolK03F8:Expr
Expression_data (2)
TypeReporter_gene[acr-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCAGAGCCGACTTCCATAA] 3' and primer B 5' [GTTGGGAAGGATGCTGAAAA] 3'.
PatternAdult Expression: Nervous System; head neurons; neurons along body; unidentified cells in tail ;
Larval Expression: Nervous System; ventral nerve cord; head neurons; neurons along body; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC11419
ReferenceWBPaper00006525
TransgeneWBTransgene00002589