WormBase Tree Display for Expr_pattern: Expr6329
expand all nodes | collapse all nodes | view schema
| Expr6329 | Expression_of | Gene | WBGene00010588 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00010588 | ||
| Homol | Homol_homol | K05D4:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005753 | ||
| Type | Reporter_gene | [srz-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAGATATAGCGACCGACACC] 3' and primer B 5' [AACAAAAACAAATGGATTGAAATG] 3'. | |
| Pattern | Adult Expression: seam cells; | ||
| Larval Expression: seam cells; | |||
| Remark | Also expressed in (comments from author) : GFP expression is mosaic across the population. | ||
| Strain: BC14758 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003699 |
