WormBase Tree Display for Expr_pattern: Expr6354
expand all nodes | collapse all nodes | view schema
Expr6354 | Expression_of | Gene | WBGene00000923 | Inferred_automatically |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00000923 | |||
Homol | Homol_homol | K07H8:Expr | ||
Expression_data (2) | ||||
Type | Reporter_gene | [K07H8.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATCGGACGAACTCCATCTAAA] 3' and primer B 5' [TTGATCCTGCTGCAAAGATAGA] 3'. | ||
Pattern | Adult Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
Larval Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||||
Picture | WBPicture0000005806 | |||
WBPicture0000005807 | ||||
Remark | Also expressed in (comments from author) : No comments. | |||
Strain: BC14923 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00003785 | |||
Historical_gene | WBGene00019505 | Note: This object originally referred to WBGene00019505. WBGene00019505 is now considered dead and has been merged into WBGene00000923. WBGene00000923 has replaced WBGene00019505 accordingly. |