WormBase Tree Display for Expr_pattern: Expr6361
expand all nodes | collapse all nodes | view schema
Expr6361 | Expression_of | Gene | WBGene00010665 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00010665 | ||
Homol | Homol_homol | K08E3:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005733 | ||
WBbt:0005772 | |||
WBbt:0005813 | |||
Type | Reporter_gene | [K08E3.5B::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTCATTCATTTACACAACCGTC] 3' and primer B 5' [GATGGCAAGAGCGATTGATT] 3'. | |
Pattern | Adult Expression: intestine; body wall muscle; | ||
Larval Expression: intestine; body wall muscle; hypodermis; | |||
Picture | WBPicture0000009199 | ||
WBPicture0000009200 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11584 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002628 |