Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6473

expand all nodes | collapse all nodes | view schema

Name Class

Expr6473Expression_ofGeneWBGene00000533
Reflects_endogenous_expression_ofWBGene00000533
HomolHomol_homolR07B7:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[clh-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGAAGCATAAAATGTCGGG] 3' and primer B 5' [CGGCGTACATAGTAAAATTAACCC] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulva other; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; arcade cells; pharyngeal-intestinal valve; intestine; excretory cell; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC11416
ReferenceWBPaper00006525
TransgeneWBTransgene00002586