Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6498

expand all nodes | collapse all nodes | view schema

Name Class

Expr6498Expression_ofGeneWBGene00001669
Reflects_endogenous_expression_ofWBGene00001669
HomolHomol_homolR10H10:Expr
Expression_data (2)
TypeReporter_gene[gpa-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATGCACAAACATTTTGATTTT] 3' and primer B 5' [GCAGTGACCGATTTGTGCT] 3'.
PatternAdult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells;
Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC11457
ReferenceWBPaper00006525
TransgeneWBTransgene00002599