Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6500

expand all nodes | collapse all nodes | view schema

Name Class

Expr6500Expression_ofGeneWBGene00011228
Reflects_endogenous_expression_ofWBGene00011228
HomolHomol_homolR11:Expr
Expression_data (2)
TypeReporter_gene[R11.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATACATGATTTCACTCCAGCAA] 3' and primer B 5' [GATGGCGAGCAGAGAATGA] 3'.
PatternAdult Expression: Reproductive System; vulva other; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;
Larval Expression: Reproductive System; developing vulva; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;
RemarkStrain: BC13686
ReferenceWBPaper00006525
TransgeneWBTransgene00003248