Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6594

expand all nodes | collapse all nodes | view schema

Name Class

Expr6594Expression_ofGeneWBGene00020207
Reflects_endogenous_expression_ofWBGene00020207
HomolHomol_homolT04B8:Expr
Expression_data (2)
TypeReporter_gene[T04B8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATTTGTAAAATGTGGAACGTG] 3' and primer B 5' [TGTCTGATGAGATTGGCTGC] 3'.
PatternAdult Expression: pharynx; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC11621
ReferenceWBPaper00006525
TransgeneWBTransgene00002641