Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6606

expand all nodes | collapse all nodes | view schema

Name Class

Expr6606Expression_ofGeneWBGene00006791
Reflects_endogenous_expression_ofWBGene00006791
HomolHomol_homolT04D1:Expr
Expression_data (2)
TypeReporter_gene[T04D1.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCGCTGACACCAACTCTCA] 3' and primer B 5' [CCCGACAACGAGATTTTTCT] 3'.
PatternAdult Expression: anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;
Larval Expression: anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;
RemarkAlso expressed in (comments from author) : Strain no longer available.
Strain: BC11523
ReferenceWBPaper00006525
TransgeneWBTransgene00004267