Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6616

expand all nodes | collapse all nodes | view schema

Name Class

Expr6616Expression_ofGeneWBGene00011474
Reflects_endogenous_expression_ofWBGene00011474
HomolHomol_homolT05D4:Expr
Expression_data (2)
TypeReporter_gene[T05D4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAGAACAACTGTCAACTATGGG] 3' and primer B 5' [GCGAGTAAGAAGCGATTTTAGA] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca uterine valve; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14362
ReferenceWBPaper00006525
TransgeneWBTransgene00003517