Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6620

expand all nodes | collapse all nodes | view schema

Name Class

Expr6620Expression_ofGeneWBGene00020264
Reflects_endogenous_expression_ofWBGene00020264
HomolHomol_homolT05H4:Expr
Expression_dataLife_stage (2)
Anatomy_term (11)
TypeReporter_gene[acl-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCGTATCCATTCAAAACTTCCT] 3' and primer B 5' [TTTGATATCGTCATTCTGTTGGAG] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14403
ReferenceWBPaper00006525
TransgeneWBTransgene00003538