WormBase Tree Display for Expr_pattern: Expr6622

Expr6622 Expression_of: Gene: WBGene00011543
    Reflects_endogenous_expression_of: WBGene00011543
  Homol: Homol_homol: T06E8:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0005738 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0005813
  Type: Reporter_gene: [T06E8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACTGCTCGGATAGGTGAA] 3' and primer B 5' [CGACCAGAAGTTCTCGATTTTC] 3'.
  Pattern: Adult Expression: pharynx; intestine; body wall muscle; unidentified cells in body ;
    Larval Expression: intestine; body wall muscle; unidentified cells in body ;
  Remark: Also expressed in (comments from author) : uEmbryo incomplete. To be updated.
    Strain: BC10342
  Reference: WBPaper00006525
  Transgene: WBTransgene00002201