Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6695

expand all nodes | collapse all nodes | view schema

Name Class

Expr6695Expression_ofGeneWBGene00020509
Reflects_endogenous_expression_ofWBGene00020509
HomolHomol_homolT14F9:Expr
Expression_dataLife_stage (2)
Anatomy_term (11)
TypeReporter_gene[T14F9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAAAAATGTGAGCAATCACACG] 3' and primer B 5' [GGAATTAAAAGTCGGATCACCTTA] 3'.
PatternAdult Expression: pharynx; body wall muscle; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; body wall muscle; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14144
ReferenceWBPaper00006525
TransgeneWBTransgene00003421