WormBase Tree Display for Expr_pattern: Expr6721
expand all nodes | collapse all nodes | view schema
Expr6721 | Expression_of | Gene | WBGene00020623 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020623 | ||
Homol | Homol_homol | T20D4:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T20D4.18::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAATCCATCAAAGGGTCCG] 3' and primer B 5' [GGCAATGCACTTGATAGGAAA] 3'. | |
Pattern | Larval Expression: hypodermis; Nervous System; neurons along body; | ||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products.Mosaic population. The cell body of the neuron is in the tail, and does not express in all larvae.Interesting localization pattern, possibly subcellular but seems non-nuclear | ||
Strain: BC12016 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002790 |