WormBase Tree Display for Expr_pattern: Expr6721
expand all nodes | collapse all nodes | view schema
Expr6721 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | T20D4:Expr | |
Expression_data | Life_stage | WBls:0000023 | |
Anatomy_term | WBbt:0003679 | ||
WBbt:0005733 | |||
WBbt:0005735 | |||
Type | Reporter_gene | [T20D4.18::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAATCCATCAAAGGGTCCG] 3' and primer B 5' [GGCAATGCACTTGATAGGAAA] 3'. | |
Pattern | Larval Expression: hypodermis; Nervous System; neurons along body; | ||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products.Mosaic population. The cell body of the neuron is in the tail, and does not express in all larvae.Interesting localization pattern, possibly subcellular but seems non-nuclear | ||
Strain: BC12016 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002790 |