WormBase Tree Display for Expr_pattern: Expr6726
expand all nodes | collapse all nodes | view schema
Expr6726 | Expression_of | Gene | WBGene00011884 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011884 | ||||
Homol | Homol_homol | T21B10:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0003929 | |||||
WBbt:0003931 | |||||
WBbt:0004292 | |||||
WBbt:0004506 | |||||
WBbt:0004520 | |||||
WBbt:0005300 | |||||
WBbt:0005319 | |||||
WBbt:0005342 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
WBbt:0005800 | |||||
WBbt:0005813 | |||||
WBbt:0005821 | |||||
WBbt:0006748 | |||||
WBbt:0006749 | |||||
WBbt:0006751 | |||||
WBbt:0006759 | |||||
Type | Reporter_gene | [T21B10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCTCTACGCAAGTTATTTCAG] 3' and primer B 5' [TCTTGGTGATTGGGATCCTG] 3'. | |||
Pattern | Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; | ||||
Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphid socket cells; tail neurons; unidentified cells; unidentified cells in head; | |||||
Picture | WBPicture0000006432 | ||||
WBPicture0000006433 | |||||
WBPicture0000006434 | |||||
WBPicture0000006435 | |||||
WBPicture0000006436 | |||||
WBPicture0000006437 | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in head, are possibly nuclei of the nerve ring. And what we thought were arcade cells, may actually be the 2 amphid socket cells. | ||||
Strain: BC11318 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002556 |