Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6757

expand all nodes | collapse all nodes | view schema

Name Class

Expr6757Expression_ofGeneWBGene00004446
Reflects_endogenous_expression_ofWBGene00004446
HomolHomol_homolT24B8:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[rpl-32::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAATTTGTTCGATGGGA] 3' and primer B 5' [TTTTACCCGAAAAGAACGAAAA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; distal tip cell; body wall muscle; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14404
ReferenceWBPaper00006525
TransgeneWBTransgene00003539