WormBase Tree Display for Expr_pattern: Expr6771
expand all nodes | collapse all nodes | view schema
Expr6771 | Expression_of | Gene | WBGene00007060 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00007060 | ||||
Homol | Homol_homol | T26A5:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005772 | Partial | |||
Remark | posterior cells | ||||
Type | Reporter_gene | [T26A5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCTCCCCCTTCATCGT] 3' and primer B 5' [GAAATTTGAAACTGATATGCGCT] 3'. | |||
Pattern | Adult Expression: intestine - posterior cells; | ||||
Larval Expression: intestine - posterior cells; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC13418 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003160 |